trspenser24 trspenser24

02-06-2022
History

contestada

Democratic Allies wanted to destroy Communism. True/False
O True
O False

Respuesta :

colinman2007 colinman2007

09-06-2022

Answer:

that is true the allies wanted to stop the spread of communism

Answer Link

Otras preguntas

Choose Yes or No to tell if the number 103 will make each equation true. 6.01 × □ = 601 No 0.305 × □ = 305 No 0.54 × □ = 540 No 0.097 × □ = 970 Yes

Lines b and c are parallel. What is the measure of angle 6?

alg 2 complex numbers in standard form! please help me :(

What is the primary purpose of a slideshow presentation

Four solutes are added to a solvent. All solutes have the same mass and solubility. The surface areas of four solutes are 2 mm2, 4 mm2, 6 mm2, and 10 mm2. Which

1. If all four switches below are turned on, which light bulb will light up? (W is wood, S is silver, and Yis yarn.) A.Circuit A B. Circuit B C. Circuit C D. C

the area of a rectangle is 177 square meters the width is 9 meters what is the length of the rectangle

Nonverbal communication Definition

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

The actual cash received from cash sales was $36,006 and the amount indicated by the cash register total was $36,010. Journalize the entry to record the cash re