ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

What is 6(5+7)+21=?????????

Scientists notice structural similarities between fossils of a land animal and aquatic organisms they know the similarities are not a result of the two organism

Researchers may control factors that might influence a dependent variable by means of A) random assignment. B) replication. C) naturalistic observation. D) oper

The South’s climate is warmer than other regions in the United States farther north because _____. A. it has lush mixed forests B. it has less precipitation c.

URGENT PLEASE HURRY!!1.)What is the perimeter of the shape?12 feet14 feet26 feet38 feet2.)What is the perimeter of the shape?30 inches40 inches60 inches72 inche

What kind of reaction occurs when a molecule of glucose reacts with oxygen to give carbon dioxide and water?

Eight more than the product of a number and 2 is 3

PLEASE HELP ASAP!!! CORRECT ANSWER ONLY PLEASE!!! Question 10 (3.5 points) The following sentence may have an error in effective writing. Choose the best revisi

1,35,36,37,37,38 mean median mode

Help Don’t put whatever I already got -4