dominjul000 dominjul000
  • 02-06-2021
  • Biology
contestada

how is the end result of technology best described as

Respuesta :

debojitroy1
debojitroy1 debojitroy1
  • 15-06-2021

Answer:

products or processes that solve problems.

Explanation:

Answer Link

Otras preguntas

What is the Songhai empire describes as being
Sharon has a square picture frame with an area of 400 inches squared. She wants to decorate one side of the frame with ribbon. What is the amount of ribbon she
What is the mass of 1.794 mol Ba(NO3)2?
What’s the rate of change of y=5.75x-2.5(x-2)
HELP THIS IS FOR A TIMED TEST Luis bought the stock at $85.00. The next day, the price increased by $15.25. This new price changed by −6 3/4% the following day.
Suppose the amount of a popular sport drink in bottles leaving the filling machine has a normal distribution with mean 101.5 milliliters (mL) and standard devia
All of the following statements about the battle of Gettysburg are true EXCEPT
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Give your answer in simplest form.
In Andrew Jackson's presidency, evaluate the extent to which Democrats were accurate in their view of themselves as guardians of economic opportunity.