DeAngeloStokes2689 DeAngeloStokes2689
  • 03-03-2020
  • Social Studies
contestada

In addition to performing routine backups, record all the updates you make to your workstation by using a process called ____ when planning for disaster recovery

Respuesta :

SerenaBochenek SerenaBochenek
  • 03-03-2020

Answer:

The correct answer to the following question will be "Configuration management ".

Explanation:

  • It is only the representative body of procedures, practices, techniques, and strategies that project administrators may employ to handle objects throughout the life span of that same venture or project.
  • It deals with the structure of a project, its determining documents, as well as other factual support.

Therefore, it's the right answer.

Answer Link

Otras preguntas

What Is 2+2 please help
Kelly rolls two number cubes. Determine the probability of each of the following events. Express each probability as a fraction in simplest form. A. The sum
Thick fur to stay warm is it physical or behavior adaptation​
What is meant by ‘49’s
Okay so i have to write a poem for world history and I am really bad with writing. Its about world war 1 and 2. can someone please help me out! 17 points and br
does someone know how much is the new MacBook pro 2020 (1,200) but with the student discount ?​
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG
How do u find the unknown angle measure in a triangle
Mrs. Morton has a special reward system for her class. When all her students behave well, she rewards them by putting 3 marbles into a marble jar. When the jar
what is 1/10+ 3/100 in fraction from