Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

what is the importance of prehistory

A waterfall in a park is located 6 miles east and 3 miles north of the visitors center. There is a picnic site 1 mile east and 2 miles north of the visitors cen

The______(1)_______ were skillful artisans with ceramics. They developed their own form ofceramics known as ______(2)_______ over 10,000 years ago. a. (1) Chine

Which of the following sentences has problems with misplaced or dangling modifiers? Check all that apply. A. After reading the whole book, the plot seemed a li

)What Byzantine city was a wealthy center of trade that maintained the commercial links between Europe and Asia?

what caused the renewal of interest in the classical civilizations of greece and rome

should eighth be capitalized if use in a sentence

Which of the following is not part of testing a hypothesis? A. Gathering evidence B. Reasoning C. Collecting data D. Modeling

7e−4=31 solve for e.

What is the primary purpose of writing a lab report?