11-10-2018
Physics

contestada

what is the force if the mass is 75kg and the acceleration is 24.5m/s^2

Respuesta :

taibamah taibamah

11-10-2018

Given;

mass m = 75 kg

acceleration a = 24.5 ms²

F = ma

F = 75 kg * 24.5 ms²

= 1837.5 kg ms².

Answer Link

Otras preguntas

How does Elwood feel that no ones knows how he got out of nickel

An elevator in an old building can hold four people at a time. The elevator also has an overall weight limit of 800 pounds. The weight of a group of people in t

How many feet are in 6.75 miles? (6.75x1) divided by 5280 =

What excuse did air force officers give for not using women pilots

what is the planet that scientists are exploring now?

2( x + 7) - (-18 + 4/5)

give evidence that people who look at their phones every minute never have a good relationship give up to 2 statements as to why

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

9 decreased by 4 times a number

knew song I have given all my love to you, but what do I get in return? A broken heart. I have given you my heart, and you stomp on it like a doormat. I have