RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Respuesta :

addysenseheult addysenseheult

14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

Find the probability of selecting 4 science books and 3 math books from 11 science books and 14 math books. The books are selected at random.

23. A candidate who gets 36% marks in an examination fails by 24 marks but another candidate, who gets 43% marks, gets 18 more marks than the minimum pass marks

11. Tungsten can also be obtained by reacting tungsten fluoride with hydrogen. The equation for this reaction is WF6 + 3H2 à W + 6HF (i) In an experiment, a che

Terrell calculated the interior angle sum of a 13-sided figure to be 2,340. is Terrell's calculation correct? Explain.

Find the probability of selecting 4 science books and 3 math books from 11 science books and 14 math books. The books are selected at random.

lisa borrows $18 000 over 5 years from the bank. The loan is charged at 8.4% p.a. simple interest. Find the total amount owing at the end of 5 years. (2 marks)

Danni a mixes red and yellow paint to get orange paint. In the previous mix there were 400ml of red paint. She decreases the amount of red paint in the ratio 7

Question 1a. The following equation models the spread of a disease: Where: N(t) is the number of people infected at the time. N0 is the initial number of i

why is the relative atomic mass of tellurium greater than the relative atomic mass of iodine?

What color is the sky