maryamapplebery7056 maryamapplebery7056

03-05-2018
Geography

contestada

The net primary productivity of cultivated land is most similar to the net primary productivity of which ecosystem?

Respuesta :

maylyn1292 maylyn1292

12-05-2018

The net primary productivity of cultivated land is most similar to the net primary productivity of the temperate grassland. Temperate grassland is a terrestrial ecosystem whose main plants consist of shrubs or grass. The environment is temperate and it ranges from semi-humid to semi-arid.

Answer Link

Otras preguntas

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

1.) Which expression is equivalent to 2.3 X 2.3 X 2.3? * O A.) 2.3X5 B.) 2.39 O C.) 22 X30 O D.) 2.31

a tree is sold based on the circumstances of the tree .if a tree has a radius of 4 inches then what is the circumference of the tree

(c) Rashid has 210g of cocoa powder and plenty of the other ingredients. He says that he can make at least 75 cupcakes. Is he correct? Explain your reasoning.

will give brailiest if you answer it correctly

Read the following plot synopsis: Callie wanted nothing more than to be on TV. She went to Hollywood to try to get a part. At first things were tough, but event

Find the missing side and angle to the nearest tenth. AC= m∠B =

Find 8 1/3% of 72.

What is the most abundant plant hormone and where is it found in the plant?

What is baking powder