kdogpinke1Ggi5 kdogpinke1Ggi5
  • 16-02-2016
  • English
contestada

Mr. Ferguson startled the class by requiring (it, them) to write short autobiographical poems.
a. it
b. them

Respuesta :

Hagrid
Hagrid Hagrid
  • 16-02-2016
The answer to that question is them. The class is a collective noun for a bunch of students that are learning from a teacher. Since we are referring to people, then we cannot use it because the noun it is used for inanimate objects. Pronouns like them are used to refer to people
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is 15/24 in simplest form
What is the sum of 6/10 plus 7/12
what might be learned from an incorrect hypothesis
how do you say theatre in Spanish
round 7,782 to the nearest hundred
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
what are 2 points on the graph for 6x-5y=25
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before