nickdaurelio2 nickdaurelio2
  • 04-03-2018
  • Mathematics
contestada

Need the answer fast, anyone know?

Need the answer fast anyone know class=

Respuesta :

lcamel4p51lnv lcamel4p51lnv
  • 04-03-2018
Y<-1/2x
Y> or = -1
Because if you plug in a number then it's the only one that fits
Answer Link

Otras preguntas

NO LINKS!! Please help me with these questions. Part 2cc​
Write a 1 page (minimum) Native American Myth. Must have 2 animals, 2 explained, unexplainable things
a line that returns to the x axis tells us the object is?
anyone become my good and caring sister forever​
In two to four complete and grammatical sentences, please explain how the environmental ethics philosophy known as "holism" (ecocentrism) is different from the
A newsletter publisher believes that 43% of their readers own a Rolls Royce. A testing firm believes this is inaccurate and performs a test to dispute the publi
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
What is the prime factorization of 168? 22 x 32 x 5 34 x 7 22 x 17 23 x 3 x 7
Define In On Seeing England how does the author change or refine the meaning of the term “special jewel” over the course of paragraph 1? Explain
In 1989 during the World Series baseball championship in San Francisco, California, an earthquake caused roads to collapse, buildings to catch on fire, and the