monirh1976
monirh1976 monirh1976
  • 04-01-2018
  • Mathematics
contestada

this does not help !!!!!!!

Respuesta :

kenide992
kenide992 kenide992
  • 04-01-2018
You didn't post nothing for the question darling
Answer Link

Otras preguntas

in the diagram PQRS is a circle centre O. If angel POQ = 150° angle QSR= 40° and angel SQP= 45° calculate angel RQS.
Scenario ACollege graduates are moving back in with family in record numbers. They are waiting longer than previous generations to buy homes and start families.
Select the graph for the solution of the open sentence. Click until the correct graph appears. |x - 1| < 4
Diamond Threads Alterations received $200 in cash for altering a wedding dress. Which of the following accounts is credited?
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
In Act V, Macbeth considers the prophecy "Macbeth shall never vanquished be until / Great Birnam Wood to high Dunsinane Hill / Shall come against him" a sign th
in what part of united states are the appalachian mountains located
Can you make a word from the jumbled letters vnprtsopvd join fast
Find the x-intercept of the line 3x + 19y = -18
Помоги пж срочно!!! Пж​