samuelq2017 samuelq2017
  • 14-12-2017
  • Biology
contestada

In what ways are female and male reproductive system different

Respuesta :

bassman1910
bassman1910 bassman1910
  • 14-12-2017
The male has a penis, girls have a vagina. Males have sperm, girls have eggs
Answer Link

Otras preguntas

_AgNo3(aq) + _Na2Co3(aq) = 1. Predict the products of the reaction including the states of matter for each product. 2. Balance the equation. Please help me.
A parrot is sold for 30% off the original price. If the sale price of the parrot was $56, what was its original price?
Which country is NOT labeled on this map?
The excerpt supports the conclusion that Gertrude ignores what Hamlet says because she thinks he’s crazy. can’t bear listening to Hamlet because she knows he’s
How were prisoners from the war handled?
why does Brutus think it would not be a good idea to ask see Cicero to join the conspiracyA. because Cassius thinks Cicero is a loyal supporter of Caesar he doe
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
How is the liver adapted to its regulatory functions​
they said, "a friend in deed is a friend indeed. indirect speech​
Hello please help me