jekskskskssksk jekskskskssksk

02-10-2017
Mathematics

contestada

Answer Choices:

A. 70 degrees

B. 50 degrees

C. 110 degrees

D. 60 degrees

Answer Choices A 70 degrees B 50 degrees C 110 degrees D 60 degrees class=

Respuesta :

Raiahr01 Raiahr01

02-10-2017

The answer is D. 60'. You add both angles together, then subtract them from 180.
60+70=120
180-120=60

Answer Link

Otras preguntas

Describe the end behavior of the function graphed below.

Marjorie bought a new car with some miles already clocked on it. She kept track of the miles she put on her new car each day, as shown on the graph below.

toute la page 117 du sésamth 3e

Help with 6.a. Pls thanks ;)

Integrate h(x,y)=yi+xj over the circle of radius 1 centered at the origin traversed counterclockwise.

Use the image below to answer the following question. Find the value of sin x° and cos y°. What relationship do the ratios of sin x° and cos y° share? A right t

How long will it take for 20% of the C-14 C - 14 atoms in a sample of C-14 C - 14 to decay? half life:5730 years

Determine whether there is enough information to prove that each pair of triangles is congruent by SSS or SAS. Write the congruence statements to justify your r

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

donner la notation scientifiques de chaque nombres : 49 millions 320 millièmes 1400 milliards 0,08 cent-millième 57 centaines de mille 5 milliards