nope6571 nope6571

13-02-2024
Medicine

contestada

An internal hemorrhoid that protrudes outside the anus on straining but reduces spontaneously is
a) Grade I internal hemorrhoid
b) Grade II internal hemorrhoid
c) Grade III internal hemorrhoid
d) Grade IV internal hemorrhoid

Respuesta :

Otras preguntas

Which of the following is NOTone of the three main questions of economics? a. What do we produce? b. How do we produce it? c. Why do we produce it? d. Who are

What is the value of x? 2x+20 3(x-10)

Which outcome resulted from the British gaining control over the Dutch colony in North America?

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Find the slope of the line that goes through the points (9,-13) and (7,3).

4.5/w = 3 what is the W?

In Common Sense, Thomas Paine argued that the colonies O A. had no obligation to remain under British rule. o B. should open negotiations with the British Parli

What is the range of the function f(x) = 12 − 3x for the domain {-4, -2, 0, 2, 4}?

30% of a number equals 30. what is the number?

GE = 5x+36 and GF=2x+51 . What is the value of x?