Angirls0405 Angirls0405
  • 01-08-2017
  • Mathematics
contestada

Solve for x: the quantity of x plus 4 all over 2 = 7.

x = 3
x = 5
x = 6
x = 10

Respuesta :

lamanleyotnlo3 lamanleyotnlo3
  • 03-08-2017
the actual answer is 10 , 10 plus 4 is 14 and 14 divided by 2 equals 7 so the answer is 10
 i hope this helped

Answer Link

Otras preguntas

On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
Graph the first six terms of a sequence where a1 = -10 and d = 3.
the temperature of a sample of matter is a measure of the ?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
how do you say theatre in Spanish
what might be learned from an incorrect hypothesis
how to i do 7/16÷(31/2÷1/2)
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5