Rosalinda27
Rosalinda27 Rosalinda27
  • 01-06-2017
  • Mathematics
contestada

Help me in geometry please :(

Help me in geometry please class=

Respuesta :

wbdavid1998 wbdavid1998
  • 01-06-2017
D 60 degrees a 40 degree or anything less is going to be a smaller angle in appearance anyways
Answer Link

Otras preguntas

Let p and q represent the following simple statements P: I study q: I get an A Write the symbolic statement ~(qvp) in words
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
1. Mateo brought in donuts for his class. Each box had 3 rows of donuts with 5 donuts in each row. He bought 8 boxes. How many donuts did he buy?
Below is the table of values of a function. Write the output when the input is n. input 1,4,6,n output 2,8,12,?
When stars are moving away from a telescope, what shade do they appear to be compared to the normal light they emit?
Solve for pressure #2 using Bernoullis equation
Based on the information provided in both Source C and Source D, which statement is true? • PACs have multiple bank accounts in order to manage their large dona
Cómo se hace un ciclo contable
Alex tracked the number of cups of coffee he drank each day for the following month and created a new probability distribution. Number of Cups of Coffee, X 0 1
Find the equation of a line parallel to the line 2x + y -7 =0 and passing through the intersection of the lines x + y -4 = 0 and 2x – y = 8 . With explanation