Seudónimo Seudónimo
  • 13-02-2017
  • Mathematics
contestada

Can someone help me with this?

Can someone help me with this class=

Respuesta :

KeshonH KeshonH
  • 13-02-2017
3.2 over 0.4 is equivalent to 8
Answer Link
kyokkirigiri100
kyokkirigiri100 kyokkirigiri100
  • 13-02-2017
3.2 / 0.4 = 8
The reason to this is because 0.4 goes into 3.2 8 times
Answer Link

Otras preguntas

Do all your pet's offspring look the same? If no, then explain why they look different.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
who was the founder of Pennsylvania?
A generator stores electric current. Explain why you agree or disagree with this statement
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.