riquito07 riquito07
  • 13-09-2022
  • Mathematics
contestada

$7.99 by 16.2 ounces

Respuesta :

khanhaziq732
khanhaziq732 khanhaziq732
  • 13-09-2022

Answer:

.49 if you're dividing them.

Step-by-step explanation:

Answer Link

Otras preguntas

What is the solution for the system of equations? Use the substitution method to solve. 2x+y=20−5y=−6x+12 Enter your answer in the boxes. ( , )
help 50 points for the people who help! Which of the following is an example of how the Constitution sets up a balance of powers between the three branches of g
Which equation best represents a trend line for the scatter plot? y=−3/7x+4 y=3/7x+4 y=−7/3x+4 y=7/3x+4
A rectangular goat pen has an area of 40 square meters. Its perimeter is 26 meters. What are the dimensions of the pen?
In the To Kill a Mockingbird excerpt, we learn that Atticus Finch is an ancestor of
Cual de las siguientes afirmaciones describe mejor la situacion de la investigacion cientifica en latinoamerica segun el articulo
Cual de las siguientes afirmaciones describe mejor la situacion de la investigacion cientifica en latinoamerica segun el articulo
most water vapor in the atmospher is the source of a. couds and rain. b. pollution c. carbon dioxide d. wind.
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
Carl puts 1.10 in his penny bank every day in the month of July. His total savings was 55at the end of June. What’s the best estimate for Carl’s savings at the