tippettmichelle36
tippettmichelle36 tippettmichelle36
  • 04-09-2022
  • Mathematics
contestada

a figure is made of to rectangular prisms what is the volume?

a figure is made of to rectangular prisms what is the volume class=

Respuesta :

LertexGaming LertexGaming
  • 04-09-2022

Answer:

why did u delete my comment

Step-by-step explanation:

Answer Link

Otras preguntas

a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Graph the first six terms of a sequence where a1 = -10 and d = 3.
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
How did the mountains in Greece contribute to the rise of city-states?