Adventurejade Adventurejade

03-05-2022
Mathematics

contestada

Simplify. (1/2k)(4k)+12
14 k
2 k^2+12
14 k^2
2 k+12

Respuesta :

Jadepchavez Jadepchavez

04-05-2022

Answer:

2k^2+12

Step-by-step explanation:

remove parentheses, simplify calculate

Answer Link

Otras preguntas

Answer these questions and label each answer with the correct number. 1. List the stages in the technology design process. 2. What are prototypes used to test?

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se

Which abiotic factor is the primary source of energy for all organisms

You receive a call that a mountain lion that was seen several times in a local neighborhood has been found chased up a tree by dogs in rural berkshire county, m

A zygote is the product of fertilization. The diploid zygotes of the four organisms seen here all underwent __________ and _____________ in order to produce the

Why is graphite used instead of gold or copper wires to conduct electricity in very hot situations such as an industrial kiln?

For each figure, which placement of the axes shown would be the best to prove properties about the object?

The ____ function can be used to determine the number of rows containing a specified value.â€‹

An ecosystem is effected by many factors. Oxygen, soil, water, amount of sunlight, and temperature are some examples. What type of factor are these examples?

??? Fifteen points :)