edgardandres81 edgardandres81
  • 01-03-2022
  • English
contestada

write a five stanza poem about culture

Respuesta :

Thegoodanswer Thegoodanswer
  • 01-03-2022

Answer: Two stones of crystals butterflies are perching upon silence, and coolness of earthen chemistry of electric-purity-energy. A post-conceptual map of abstract integrity of pure and harmonious balance of originality of natural flow of water on earth.

Have a blessed day

Answer Link

Otras preguntas

Solve for x. 20 points!
Find the distance between each pair of points. (7,-3), (-6,1)
sneha obtains 240 marks out of 600 vijay obtains 490 marks out of 700 whose performance is better​
African music rarely included group singing true or false
What is the function of the reproductive system?​
Explain the historical circumstances of Hitler and Chamberlain's agreements in the Munich Pact (1938).
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
Regular meditation has marvelous power to make one’s life. true or false​
I’ll mark brainliest if someone can answer this correctly
A boat looks up at a light house at an angle of elevation of 23.If the top of the lighthouse is 450 feet higher than sea level, what is the horizontal distance