ScienceFox ScienceFox

03-02-2022
Mathematics

contestada

Will mark brainiest! Please help me with this equation... can you also please show your work? thank you.

Will mark brainiest Please help me with this equation can you also please show your work thank you class=

Respuesta :

roshellruiz14 roshellruiz14

03-02-2022

Answer:

this is the answer

41

Answer Link

Otras preguntas

The first term of an arithmetic sequence is −12 . The common difference of the sequence is 7. What is the sum of the first 30 terms of the sequence? Enter you

Given the following linear functio, determine the slope of a line parallel to f(x) F(x)=4/3x+2 A.2/3 B.-4/3 C.4/3 D.-3/4

In which type of research would an investigator manipulate one factor and observe its effect on some behavior or mental process?

A linear equation with an infinite number of solutions is called?

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

The Nardo ring is a circular test track for cars. It has a circumference of 12.5 km. Cars travel around the track at a constant speed of 100 km/h. A car starts

To evaluule f(x) = x + 7

what is 209/50 as a fraction

Nora observed people in her college for several months and then determined if there was a pattern in the different responses of young and old students. Which on

2) Jake has three pieces of ribbon. The lengths of the ribbons are 136.7 centimeters, 136.85 centimeters, and 104.9 centimeters. What is the difference in lengt