sparkles99074 sparkles99074

02-06-2021
Mathematics

contestada

which of the following is a non-real complex number?

which of the following is a nonreal complex number class=

Respuesta :

emergenitro emergenitro

02-06-2021

Answer:

D

Step-by-step explanation:

D consists of the square root of -9/5

Which is not possible with real numbers - Only possible with complex numbers (i.e i)

Feel free to mark it as branliest :D

Answer Link

Otras preguntas

this is a class called foundation seminar music and math

How is the creation of public policy in Russia different from that in the United States?

a triangle has a measure of 30. The other two angles are in a ratio of 7:8. What are the measures of those two angles?

30. Chronic alcohol abuse damages T-cells, white blood cells, natural killer cells, and __________, all important components of the immune system. A. acetaldehy

HELP ASAPIdentify the property used in each step. 12.2 + 18.6 + –4.3 + (–18.6) 12.2 + –4.3 + 18.6 + (–18.6) 12.2 + –4.3 + [18.6 + (–18.6)] 12.2 +

what does a light year measure

the push or pull that exists between interacting objects is

When you prepare to make a left turn from a one-way road into a two-way road, you must:?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

A newly formed country in the Caribbean has no high tariffs, yet other countries find it difficult to trade with the new country because of its requirements for