Iza13
Iza13 Iza13
  • 14-05-2021
  • Mathematics
contestada

Find the area of the figure below. * 23 cm 12 cm 18 cm 15 cm ​

Find the area of the figure below 23 cm 12 cm 18 cm 15 cm class=

Respuesta :

akposevictor
akposevictor akposevictor
  • 05-04-2022

The area of the figure = area of trapezium + area of rectangle = 420 cm².

What is the Area of a Trapezium and Area of a Rectangle?

Area of trapezium = 1/2(a + b)h

Area of rectangle = length × height.

The area of the figure = area of trapezium + area of rectangle

The area of the figure = 1/2(a + b)h + length × height

Plug in the values

The area of the figure = 1/2(23 + 15)6 + 23 × 12

The area of the figure = 144 + 276

The area of the figure = 420 cm²

Learn more about area of trapezium on:

https://brainly.com/question/16904048

Answer Link

Otras preguntas

Give a recursive algorithm for finding the sum of the first n odd positive integers.
The Panama Canal connects what two bodies of water?
does radiation need a phase of matter to travel with?
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
In which system of government would states function independently of each other?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Where did middle names come from
Why did we use coin-flipping as a method to choose traits for the parent pets and the offspring pets?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10