4kaytray16
4kaytray16 4kaytray16
  • 03-05-2021
  • English
contestada

yall trying to make a pad..........let

Respuesta :

victorvosper8
victorvosper8 victorvosper8
  • 03-05-2021

Answer:

bet

Explanation:

Answer Link
alexellisnash
alexellisnash alexellisnash
  • 03-05-2021

Answer:

sure why tho

Explanation:

Answer Link

Otras preguntas

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
What characteristics of eukaryotic cell gives them greater capacity for specialization than prokaryotic cells?​Explain your answer.
(2) How do unsocial people take undue advantage of a calamity? ​
Examine the healthcare and support services available to ana individual requiring multidisciplinary care
Which phrase is an example of kinetic energy?
An equation is shown. y-7= -4(x+6) Complete the statements. The equation rewritten in slope intercept form is [DROP DOWN 1]. The point [DROP DOWN 2] is on the g
An apartment building has 32 one-bedroom apartments, 24 two-bedroom apartments, and 16 three-bedroom apartments. How many bedrooms are in the building?
when a person eat were salt with water ? ​
The triangle below is equilateral. Find the length of side x in simplist radical form with a rational denominator.
What is the mass of an object a of 77.5 N?