kmyonts12 kmyonts12

14-04-2021
Mathematics

contestada

I need help with geometry! IXL question please please help me

I need help with geometry IXL question please please help me class=

Respuesta :

artaylor27 artaylor27

14-04-2021

Answer:

Step-by-step explanation:

multiply 11x14 then divided that answer by 858 then u get your answer

Answer Link

Otras preguntas

List several economic indicators. What is the purpose of measuring economic indicators? What do they measure?

3.2.PS-31 Jason has 26 strawberry scones and 65 blackberry scones. He wants to make as many identical bags of scones as possible. Each bag should have an equal

the sum of two numbers is 52 and their product is 100

The Constitution limits the power of ____________

is 1/8 - 10(3/4-3/8x)+5/8x equivalent to -1/8(59-35x)

Which text from "Helen Grey" explicitly states a consequence of Helen's behavior? (4 points) Group of answer choices Your eyes are bold, your laugh is loud, But

Which of the following is a section heading in the procedural document?

Read the excerpt from Blanca Flor. Blanca Flor. Believe me, the third job will be impossible to do. It will be too difficult even for my powers. We must run fro

In economics, the cost of something is a. always measured in units of time given up to get it. b. the dollar amount of obtaining it. c. what you give up to get

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA