aidanthetank aidanthetank

04-03-2021
Advanced Placement (AP)

contestada

What are communities that people had traditionally been a part of with lifelong emotional ties?
Communities of memory
Communities of emotion
Familial communities
O Communities of bond

Respuesta :

jayilych4real jayilych4real

09-03-2021

Answer:

Communities of memory

Explanation:

Communities of memory are communities in which people had traditionally been a part of with lifelong emotional ties.

Therefore, the correct answer to the question is option A.

Answer Link

Otras preguntas

Consuming alcohol during pregnancy can cause which of these conditions in a fetus?

How could we verify Micha Frazer-Carroll content of her piece?

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

What is the negation of "Everybody loves somebody sometime"

Which statement could be used to explain why f(x)=2x-3 has an inverse relation that is a function? O The graph of f(x) passes the vertical line test. Of(x) is a

write three questions about freedom of speech: on literal,one interpretive and one universal

According to the alchemist, what is the only way to learn? through experimenting through memorization through reading through action

Simplify fully 2(m+11)/10m

The manager of a commuter rail transportation system was recently asked by her governing board to determine which factors have a significant impact on the deman

In the triangular prism shown below, which lines are parallel? Select all that apply. J GJ and GH GJ and FI K H I TI F FG and FH I and FG