opuhiuvhjhj opuhiuvhjhj
  • 03-03-2021
  • Mathematics
contestada

find the sum to d
1.5d+3.25=1+2.25d

Respuesta :

destinyis13 destinyis13
  • 03-03-2021

Answer:

D = 3

Step-by-step explanation:

Answer Link

Otras preguntas

Now let's see what the face of the Moon looks like from the Earth over the course of a month. Change the date to March 7, 2008, at 6:00 AM. Find the Moon and zo
? Question Use the order of operations to evaluate this expression: (-2+ 1)2 + 5(12 ÷ 3) - 9. Type the correct answer in the box. Use numerals instead of words.
What is the image point of (1,8) after a translation left 2 units and down 1 unit?
Someone please help me!
Which of the following is a solution to the inequality below? 4 > q
find the x and y intercepts y-3x=18
15.11 + (142 x 16.5) what is the solution to the correct number of significant figures
Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
Please help me it would make my whole month please!!! ILY
What are 3 key takeaways you have about investing in a 401(k) plan that will help you when you’re ready to make this decision in the real world?