zuzannap871
zuzannap871 zuzannap871
  • 03-03-2021
  • Mathematics
contestada

Please do it quick i need it and the quiz shuts off in 5 minutes ​

Please do it quick i need it and the quiz shuts off in 5 minutes class=

Respuesta :

ayohelpme
ayohelpme ayohelpme
  • 03-03-2021
a) is 60% b) is 65%.
Answer Link

Otras preguntas

Answer question with steps get brainliest! Please answer ASAP with steps. Use picture above
The measure of FHJ is 35º. The measure of FGH is 20°. What is the measure of HFG? ​
1. Determine the dosage (include unit). Order: Humira 20 mg subcut every other week available: Humira 40mg/ 0.8 mL 2. An IV with 1,050 mL D5W infusing at 60 mL
Was Robinson Crusoe lucky ?
Which equation has no solution? 0 14x-21=-6 012-x1=9 O 13x + 61 = 6 O 1-2x+81 = 0
Give slope for these points blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah blah bl
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
Find the product -20 • (-4) =
The integer 5 makes which of the following equation false
NEED HELP PLS If you weigh 982 N on Earth, what would your weight be on the surface of Jupiter? g = 9.8 m/s^2 on Earth's surface g = 26.0 m/s^2 on Jupiter's sur