vsco vsco
  • 01-03-2021
  • Mathematics
contestada

HELPPPPPP ASAPPPP PLSSSS

HELPPPPPP ASAPPPP PLSSSS class=

Respuesta :

aleeshasaji
aleeshasaji aleeshasaji
  • 01-03-2021

Answer:

a. 43

Step-by-step explanation:

This question is asking how much candy he had initially.

This means that t = 0 days

Thus anything to the power of 0 is just 1.

Hence: 43 x 1 = 43 candies

Answer Link

Otras preguntas

A woman wishes to enclose a rectangular garden with fencing, using the side of her garage as one side of the rectangle. A neighbor gave her 27 feet of fencing,
Differentiate between developing and developed countries
Sarah works two jobs over the summer. She is a waitress, earning $11 per hour, and she is also a babysitter for three kids, earning $18 per hour. Sarah currentl
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
what type of cell is the central vacuole ?
In the case of Texas v. Johnson, how did the U.S. Supreme Court protect the right of free speech?
i need help helping my brother asap Evaluate the equation. 7.15e = 64.35 A. e = 8 B. e = 9 C. e = 460.0125 D. e = 460.1025
Is the quotient of -125 and five positive negative or zero
DNA is a polymer consisting of monomers know as A( peptides B( amino Acids C( nucleotides D( phosphates
Bridgeport Inc. has negotiated the purchase of a new piece of automatic equipment at a price of $10,080 plus trade-in, f.o.b. factory. Bridgeport Inc. paid $10,