amberd30 amberd30
  • 12-02-2021
  • Mathematics
contestada

Which value from the set {20, 40, 150, 250} makes 2.5x = 100 true?

Respuesta :

noahc808
noahc808 noahc808
  • 12-02-2021

Answer:

40

Step-by-step explanation:

Answer Link

Otras preguntas

How do you the ancient Egyptians increase their powers and wealth
What is the form of the Difference of Squares identity ? A. a ^ 2 - b ^ 2 = (a - b)(a - b) B. a ^ 2 + b ^ 2 = (a - b)(a - b); a ^ 2 - b ^ 2 = (a + b)(a + b) O a
each front tire on a particular type of vehicle is supposed to be filled to a pressure of 26 psi. suppose the actual air pressure in each tire is a random varia
The first slave to arrive in SC came form A Portugal B England C Barbados D Bahamas
IN HURRY！！！！ Questions 8 - 10, deal with the ambiguous SSA case. For each, find all possible solutions and sketch the triangle(s) in each case. 8. A = 50, a = 15
Use the following emphasis and organizational cues in a sentence. 1.Let me emphasize _______________ 2.You need to think about ____________________ 3.Let me ma
example of onomatopoeia
What are three advantages and three disadvantages of globalization
pls help asap if square x = -7 ; then x = - 49
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'