ereanser ereanser

15-01-2021
Biology

contestada

AGTACTACGTTGCTTAGTGCTAGCTTAGCTATA

How many codons are there in this strand, from left to right?

Respuesta :

autumnstoddard84 autumnstoddard84

15-01-2021

Answer: should be 11!

Explanation: every 3 letters = a codon
There are 33 codons, divide it by 3 and get 11! Or you can count by 3’s until the end

Answer Link

Otras preguntas

Temperature has a(n) _____ effect on the pressure and volume of a gas. A. direct B. inverse C. positive D. negative

A bus on a regular schedule takes 3 1/4 hours to reach its destination. The express bus takes 2 1/2 hours to make the same trip. How much travel time can be sav

Roundworms have _____ muscle that helps them move. striated circular longitudinal retractor

What reforms did Julius Caesar put in place that increased his popularity with poor and working class Romans

44.88 divided by 1.2

what are 5 of the most common medical records documents

The curved top surface of a liquid column

How did the two main political groups get their names.

If you have two objects with equal volume, do they have the same mass? Explain.

Sexual attraction to people of both sexes is called: Answer heterosexuality. bisexuality. homosexuality. asexuality.