Seudónimo Seudónimo
  • 15-01-2021
  • Chemistry
contestada

pleas HELP QUICK!!!!!!!!!!!!!!!!!

pleas HELP QUICK class=

Respuesta :

bhattiabdul777 bhattiabdul777
  • 15-01-2021

Answer: first is last second is first and 3rd is second

Explanation:

Answer Link

Otras preguntas

HEEEELLLPPP! List 5 facts about Abraham Lincoln in your own words, including stuff about his presidential term.
why do they use the letter k for equilibrium
Energy from the food makes the biker's muscles contract. So some of the energy in the muscles is transformed into what type of energy?
A game Room has a floor that is 120ft by 75ft. A scale drawing of the floor on grid paper uses a scale of one unit : 5 feet. What are the dimensions of the sc
who was tarquin the proud? what were his main accomplishements to rome?
What did most women learn in school in the 1800s?
Zolox worked 38 hours last week. He had $88 deducted from his earnings for taxes. If he had $273 left after the deduction, how much does Zolox earn per hour?
What aspects of the national government exemplify the framers plan to have representatives focused on national rather than personal interest
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
A tow can pull a car out of a ditch in 7.5 seconds. How many work is done if the truck has power of 5500 watts?