cheyyy5 cheyyy5
  • 14-01-2021
  • Biology
contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya
angelomontoya angelomontoya
  • 14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

The first immigrants to the United States were mainly from England, Scotland, Ireland, Germany, and A. Russia. B. Italy. C. Scandinavia. D. Greece
The sum of three integers is 92. The second number is three times the first number. The third number is ten less than twice the first number. Find the integers.
PLEASE HELP I GIVE THANKS1. __________ is the "set up" where the setting and characters are introduced. (Points : 5) Plot External conflict
Find all complex solutions of the equation x^4 + x^2 - 6 = 0
What tradition did the Bantu people bring with them throughout their migrations? farming hunting and gathering trading craftsmanship.
Which of these gymnosperms are known to be important in maintaining the balance of carbon in an ecosystem? garden flowering plants ferns and liverworts mosses a
approximate square root 250 to the nearest tenth
WHich is shorter 3/4 of a minute or 2/4 of an hour
How are the sun ray's like mathematics rays?
how many colonies were founded in the 1620's?