ksan71478 ksan71478

05-01-2021
Mathematics

contestada

Round to the nearest percent.
From 13 friends to 19 friends
what is the percent increase?

Respuesta :

heahama21 heahama21

05-01-2021

Answer: 19

Step-by-step explanation:decrease this is really easy truest me wait actually dine lmoa hahah

Answer Link

Otras preguntas

Which of the following defines anxiety disorder? A. a blanket term that covers conditions of the brain that affect human behavior B. a blanket term that cover

Order the following numbers from least to greatest. Put the lowest number on the left. 50 25 0 -75

Solve the equation for x 1/2(12x-10)=1/3(9+6x)

Helppppp plz tell me the right answer

Find the prod (4x+5)(5x +9) OA. 0.2

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

Find the product of-10/5 x (-15/5)

a scenario involving functions of a business

Which of these phrases uses parallelism to create a sad tone?

The particles that make up a solid move ? than do the particles that make up a gas. A. In the same way B. More quickly C. More quickly and farther D. Mor