brianas86
brianas86
02-11-2020
Spanish
contestada
Can someone help me
Respuesta :
zarampa
zarampa
02-11-2020
Answer:
Limpiemos la casa hoy
Iremos al dentista esta semana
Depositemos el dinero en el banco
Viajemos a Venezuela este invierno
Salgamos a comer este este sábado
Invitemos a los amigos de Ana
Answer Link
VER TODAS LAS RESPUESTAS ( 25+ )
Otras preguntas
Which statements include two quantities in the real world that are additive inverses?Select each correct answer.A rock climber ascends 14 feet and then descends
The estimated cost of completing a full year as a full-time student at a post- secondary institution is called: O A. full tuition O B. the PELL Scholarship. O c
The following two-column proof with missing statement proves that the diagonal of the rectangle bisect each other: Which statement can be used to fill in the
25 p I’ll put you as brainliest Blood pressure is regulated by a feedback loop, but sodium levels can affect blood pressure homeostasis. When the amount of sod
Which equation represents a proportional relationship?Pleas help me I need this ASAP, if you answer this I will -Rate you 5 star + Thank you + The BrainliestA)
A hypothetical planet has a mass one-third of and a radius three times that of Earth. What is the acceleration due to gravity on the planet in terms of g, the a
I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC
Arrange the numbers from greatest to least. 9.1x102, 918%, 1830/2, 920.0
After a 15% off sale,some jeans were $11.50.How much were the jeans before the sale?
7. You lose three points each time you answer a question incorrectly in a trivia game. If you answer eight questions in a row incorrectly, what is the change in
