aaliyahatterbury31 aaliyahatterbury31
  • 14-10-2020
  • Mathematics
contestada

Question 1
Select ALL expressions that are equivalent to 4x + 2(2x - 5) - (3 - 5x).
A
82 - 10 - 3 - 52
B
3.2 - 13
С
13 – 13
82 - 10 - 3 + 5%
E
83 - 5 - 3 - 5x

Respuesta :

melanyavram melanyavram
  • 19-10-2020

Answer:

B

Step-by-step explanation:

Answer Link

Otras preguntas

How might implementing a liquor tax and tariff benefit the nation as a whole?
which statement best describes a specific way direct democracy differs from indirect democracy
Solve the equation 2/3-4x+7/2=-9x+5/6
HELP ASAP!!!!!!!!! WILL MARK BRAINLIEST!!!!!!!!!!! 50 POINTS!!!!!!! 1. In four to five sentences compare and contrast citizens' rights in China and India. 2.
what are the four nitrogenous bases found in DNA
Explain what frame shift means and is it more or less likely to cause a noticeable mutation than a substitution
Solve for x. 5/2x+2 = 3x−1/x+1 x= 7/6 no solution x=−1 x=−1 or x= 7/6
I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC
2. What was the effect of the Dred Scott case decision? A. It unified the North in its support of slavery B. It prompted federal support of states' rights C. It
prove that[tex] log_{b}(x + y) = log_{b}(x) + (1 + log_{b}( \frac{x}{y} ) )[/tex]​