i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the complementary DNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the complementary DNA sequence for the DNA strand above class=

Respuesta :

KurdishPotato KurdishPotato

13-10-2020

Answer:

Option D)

Explanation:

In the DNA strand A comes accross Tç and C comes across G

The option justifies this rule is D)

Answer Link

13-10-2020

The picture doesn't work for me.. sorrry

Answer Link

Otras preguntas

2. Do you agree or disagree with the following statement the movement of energy in an ecosystem can exist without the moment of matter. Be sure to use the follo

a rectangular prism has a lenghth of 9 inches a width of 4 inches and a height 1 1/2 inches the prism is filled with cubes that have edge lengths of 1/2 inches

Please answer ASAP I need it in 10 minutes A savings account that earns 1% interest compounded annually is opened with an initial deposit of $250. If no further

Escriba la palabra o frase que mejor completa la oración. donde podréir a jugar básquetbol Cerca de mi casa están construyendo con mis amigos. O A. un centro co

How did the Ottoman Empire & Ming Dynasty gain, consolidate, and maintain their power?( couple sentences long) I'll know if you copied it

According to Richey, what are the "3 T's" that led to the American Revolution? List and describe all three.

I NEED THIS CORRECT ASAPP!!!

You and your friend are selling magazine subscriptions. You sell 8 fewer magazine subscriptions than your friend. Together you sell 42 magazine subscriptions.

Texas had more POW camps than any other state. How many prisoners were held in the camps? What type of work did they do

How many chromosomes would you expect to be in the daughter cells of the mosquito after meiosis? When starting with 6