i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

16 increased by twice a number is -24. Find the solution??

Which word is an interjection commonly used in advertising?

what is the meaning or definition of fighting-gear??

The dimensions of a brick that weighs 25 N are 0.19 m × 0.07 m × 0.095 m. What pressure does the brick exert on the ground if it is resting on its largest face?

if you live 35 miles from work & drive 35 mph how long would it take to get there

How consumers behaviour affect market equilibrium

Who were the Nazis ?

what is the cause and effect for the french citizens armies win their revolution for liberty and equality

The entire region of Northern Africa and southwest Asia has a climate generally described as?

Terri's teacher gives her the equation 3(5)^x=127-2x, and tells her that she will not know how to solve it algebraically. Explain how Terri could use a graph to