teka1 teka1
  • 15-09-2016
  • Mathematics
contestada

400 ones equals how many hundreds

Respuesta :

mbk1011
mbk1011 mbk1011
  • 15-09-2016
400 ones equal 4 one hundreds
Answer Link

Otras preguntas

At a certain temperature, the K p Kp for the decomposition of H 2 S H2S is 0.834 . 0.834. H 2 S ( g ) − ⇀ ↽ − H 2 ( g ) + S ( g ) H2S(g)↽−−⇀H2(g)+S(g) Initially
You are camping in the Rocky Mountains. As you look through the door of your tent, a grizzly bear stares back at you from two feet away. Your first stress respo
Which process represents a change from disorder to order?
Who do the Lotus-Eaters remind you of in The Odyssey?
Dr. Peters investigated the relationship between academic performance of middle school students and the length of recess in the school. The study revealed that
What 2 groups of of people where fighting in the Crusades which led to the closing of the overland trade route called the Silk Road?
NEED HELP NOW PLEASEEE, what algebraic expression must be added to the sum of 3x^2+4x+8 and 2x^2-6x+to give 9x^2-2x-5
Please I need some help with my Calculus homework, I cant tell what i did wrong!
A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT Question 1 options: 14 and 1
What is 0.004 in precentage