rengiselle333 rengiselle333
  • 11-09-2020
  • Mathematics
contestada

Help, I don’t understand.

Help I dont understand class=

Respuesta :

yafavvkenn1
yafavvkenn1 yafavvkenn1
  • 13-09-2020

Answer:

e

Step-by-step explanation:

erffg

Answer Link

Otras preguntas

Metallic aluminum reacts with MnO2 at elevated temperatures to form manganese metal and aluminum oxide. A mixture of the two reactants is 47.2% mass percent Al.
The angle labeled in the figure 2 is equal to which of the following:
advertisement below and answer the set questions. Full of Omega 3 & 6 seed goodness Flora is made from seed oil. Seeds are high in essential fats, Omega 3 a
Use textual evidence to support your answers. 1. Describe the reunion between Lear and Cordelia (4.7.). When they are taken prisoner together (5.3.), what does
How does the muscular system fight back against the disease
how may quarters there in 5
Which of the following describes the kingdom of Mali? A.It was a Muslim Empire, ruled by Mansa Musa, and got rich with the gold-salt trade. B.It was an empire
If △ABC≅△KLM, then m∠B= [blank] −−−−−−∘. Enter the value that correctly fills in the blank in the previous sentence.
Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.
a sampple sand was found to contain 2.81 G of silicon and 3.20 gram of oxygen show that the law of Definite proportion is illustrate.​