estradabrain19 estradabrain19
  • 11-09-2020
  • Mathematics
contestada

Which fraction is equal to 6?

Respuesta :

mkjohnson0314
mkjohnson0314 mkjohnson0314
  • 11-09-2020

Answer:

12/2

Step-by-step explanation:

Answer Link

Otras preguntas

Two numbers have a difference of 0.7 and a sum of 1.What are the numbers?
Solve the equation!!! 7x + 10 = ? When x = 10 Show work!!!!
At the supermarket, there are two kinds of flour packages. If you buy 5 packs of Package A and 6 packs of Package B, the total weight of flour is 85 kg; if you
Employers are not required to A. make reasonable accommodation for employees. B. employ a person who cannot fulfill the stipulated requirements of t
What percentage of the u.s. public debt is held by federal agencies and the federal reserve? 71 percent. 50 percent. 40 percent. 29 percent?
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
sexually transmitted infectionso are widespread in the United States. Approximately half of new cases occur in which age group.A) 15-24B) 21-31C)17-26D) 19-28
probability of rolling a 10, 11 or 12 on a 12 sided die
which one of the following indicates a falling in temperaturea. the column of liquid in a thermometer moves up three degrees.b. the brass on a bent bimetallic s
What do you times by 5/9 to get 40/9