61001604 61001604

11-09-2020
Mathematics

contestada

what is the slope of a line that passes through (-4,1) and (5,2)

Respuesta :

maddiegr2006 maddiegr2006

11-09-2020

basically use the formula y1-y2 over x1-x2 and just plug in the number

Ver imagen maddiegr2006

Answer Link

Otras preguntas

Many assume that presidents with high __________ are more effective leaders.

Write each statement as an algebraic expression. The product of two numbers, p and q, decreased by three times their sum.

The length of the shorter base in an isosceles trapezoid is 4 in, its altitude is 5 in, and the measure of one of its obtuse angles is 135°. Find the area of th

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D. A

Explain the translation process that results in production of a polypeptide

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

please answer this im dying here

A newly formed country in the Caribbean has no high tariffs, yet other countries find it difficult to trade with the new country because of its requirements for

The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?

allied needs in world war 1 spurred the growth of what industry in Seattle, Tacoma, and Vancouver?A: commercial fishing B: shipbuilding C: textilesD: weapons de