dwart6ycol6ecatly
dwart6ycol6ecatly dwart6ycol6ecatly
  • 11-09-2016
  • Mathematics
contestada

simplify 8 2(10 – r).

Respuesta :

melha
melha melha
  • 11-09-2016
is the 8 with the problem?
Answer Link

Otras preguntas

If y= 3x + 6, what is the minimum value of (x^3)(y)?
A calcium atom has 20 electrons. An oxygen atom has 8 electrons. Using the electronic structures of Calcium and oxygen explain why calcium oxide has the formula
Russia and countries in Eastern Europe are in the process of moving from a __________ economy to a __________ economy. A. traditional . . . command B. mixed . .
A spinner is numbered from 1 through 10 with each number equally likely to occur. what is the probability of obtaining a number less than 4 or greater than 7 in
Which type of energy causes the biggest concerns about its impact on the landscape? A) geothermal energy B) wind energy C) tidal energy D) solar energy
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Please help solve algebra question
I will make u the BRAINLIEST pls answer this question find the mistakes in the paragraph
You coach a basketball ball team of 12 players; 5 players must be on the floor at all times; Figuring that every player can play every position.. How many tea
which equation describes the line with a slope of 2 that contains the point (4,-3)