ariadnnacastro2025 ariadnnacastro2025

15-06-2020
Mathematics

contestada

what is the primeter of a rectangular yard that is 36feet long and 40 feet wide

Respuesta :

rococo908 rococo908

15-06-2020

Answer:

152 feet

Step-by-step explanation:

Add all 4 side lengths

36 + 36 + 40 + 40

= 152 feet

Answer Link

Otras preguntas

First answer gets a brainliest, second gets a thanks! What is most likely to happen during deposition? (A) Formation of cracks in rocks (B) Moving of small

What advice does thoreau give to those living in poverty

Which statement about validity is true? Question 9 options: a) Inappropriate eligibility criteria could affect a study's construct validity. b) Attrition would

The first House of Quality relates: a. process operations to quality control plans. b. component requirements to process operations. c. customer requirements

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

jose and kaitlyn have contest to see who can throw a baseball the farthest kaitlyn wins, with a throw of 200ft if jose threw the ball 3/4 as far as kaitlyn how

2 /5 x−y=6 −2x+5y=−30 system of linear equations

Write a paragraph explaining the reliability of taking a self-report inventory personality assessment. Need answer ASAP.

8 miles per hour to travel 52 miles? A dragonfly traveled at a rate of 35 miles per hour for 2.5 hours did the dragonfly travel

La vida media de un isótopo radiactivo es el tiempo que le toma a una cantidad cualquiera del isótopo reducirse a la mitad de su masa inicial. Si comenzamos con