allisonm2468 allisonm2468
  • 12-06-2020
  • Mathematics
contestada

Helpppppppppppppppp plzzzzzzzzzzzzzzz

Helpppppppppppppppp plzzzzzzzzzzzzzzz class=
Helpppppppppppppppp plzzzzzzzzzzzzzzz class=

Respuesta :

Аноним Аноним
  • 12-06-2020

Answer:

D.

Step-by-step explanation:

If ABC is congruent to DEC 4x - 1 = x + 2

3x = 3

x = 1

Answer Link

Otras preguntas

For Constance, The Academy was the only dance school in New York. If she wasn't accepted to study there, well, then she didn't even want to dance anymore. Audit
Aaron made a picture frame with the dimensions shown in the figure. What is the area of the picture frame? 120 square centimeters 88 square centimeters 72 sq
What is the solution of the quadratic system of equations y= x^2 + 16x + 32 and y = -x^2 + 2
In 1765 Britain’s Parliament passed a text on Calendar newspaper and pamphlets call the
A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg
Heme iron is found only in foods derived from the flesh of animals, such as meats, poultry, and fish. a. True b. False
A common neutralization reaction, that is used in titrations, involves sodium hydroxide, NaOH, reacting with nitric acid, HNO3. What are the products of this re
During his 2001 MVP season for the Seattle Mariners, Ichiro Suzuki batted 0.350, meaning that his probability of getting a hit in any at bat was 0.350. In a 2
The program under which the united states, to avoid the spread of communism in europe, supplied economic aid to european nations to help them rebuild after worl
an integer that is less than zero