sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

how does wind turbin affect the climate?

HELP PLZ TIMED TEST A car is making a left turn. Therefore, what type of force is acting on the car?

Your opening balance this month was $1,664.00. In the last thirty days you made the following purchases: $27.35, $54.15, and $125.00. You are charged 15% annua

.Lines 1–15: Based on the opening paragraph, what idea will Kingsolver explore

Is a hammer a rigid body

A cylindrical can, open at the top, is to hold cm3 of liquid. Find the height, , and the radius, , that minimize the amount of material needed to manufacture th

Scholastic Furniture, Inc. manufactures a variety of desks, chairs, tables, and shelf units that are sold to public school systems throughout the Midwest. The c

What organ protects the testicles

Write an if-else statement with multiple branches. If givenYear is 2101 or greater, print "Distant future" (without quotes). Else, if givenYear is 2001 or great

Translate into English: Samuel s'intéresse tropvoisins. Il les regarde par la fenêtre avec des jumelles (binoculars).Anne ne se rend pas compteLuc ne l'aime pas