dylanswindler18 dylanswindler18
  • 05-05-2020
  • Mathematics
contestada

7x-9+3x+4 simplify by combining like terms

Respuesta :

phan420 phan420
  • 05-05-2020

Answer:

10x - 5

Step-by-step explanation:

7x - 9 + 3x + 4

7x + 3x - 9 + 4

10x - 5

Answer Link
jordan505379
jordan505379 jordan505379
  • 05-05-2020

Answer: 10x-5

Step-by-step explanation:

Combine 7x and 3x. That’s 10x.

Then combine -9 and 4. That would be -5.

Add -5 to 10x. The answer is 10x-5

Answer Link

Otras preguntas

a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Why was wilson not able to finish his speaking tour
A light bulb converts electrical energy into electromagnetic energy is true or false?
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
does radiation need a phase of matter to travel with?
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?
Fossils are most commonly found in which type of rock?