vincentdowg vincentdowg
  • 15-03-2020
  • English
contestada

What’s the Holocaust

Respuesta :

nube32
nube32 nube32
  • 21-10-2020

Answer:

Holocaust - also known in Hebrew as השואה, Shoah, translated as "The Catastrophe" -, known in Nazi terminology as the "final solution" - in German, Endlösung - of the "Jewish question", is the genocide that took place in Europe during the course of World War II under the German regime.

Answer Link

Otras preguntas

What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
How do I do trebuchet calculations????? Help me please
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
What property is shown by the equation? 1. 0 ÷ (–6) = 0
what is 0.00001267 is scientific notation
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5