davidwyllian52 davidwyllian52
  • 04-03-2020
  • Mathematics
contestada

quanto é 20% de 40% de 180?

Respuesta :

dragonhdz21
dragonhdz21 dragonhdz21
  • 04-03-2020

Answer:

14.4

Step-by-step explanation:

Answer Link

Otras preguntas

How many copies of H2 are required to balance this chemical equation? 2Al + 6HCl __H2 + 2AlCl3
When 2x - 3y = 6 is solved for y and put in the form of y = mx + b, which equation results? a. -3y = 6 - 2x b. y = (2x - 6)/-3 c. y = -2/3x + 2 d. y = 2/3x - 2
high yield variety define
Conrad explores the effects of evil and ignorance in humanity primarily by delving into various connotations of a single concept. This provides the best exampl
HELP HELP Based on the given information, choose the similarity statement that you would use to say ABC~DEF. If you could NOT conclude the triangles similar, th
Which process must the cell undergo to have identical cells at the end of cell division? A. meiosis B. mitosis C. sexual reproduction D. gamete formation
How many hydrogen bonds can CH2O make to water?
What animal changed the ways in which Native Americans could interact with their environment?
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
I don't know numbers 3 to 6 can someone please help?? thank you!